Reagents
Procedure
- Aliquot 5 ul of 2x lysis buffer into 1.5ml eppendorf tubes or a U-bottom 96 well plate
- Add 5ul of virus suspension (or controls) and mix with 2x lysis buffer
- Incubate at room temperature for 10 min
- Thaw the required amount of 2x reaction buffer and add Hotstart Taq (5u in 100ul of 2x reaction buffer). Mix and aliquot 10ul into PCR tubes.
- Add 90ul of 1x core buffer to each lysed sample and mix (vortex if convenient)
- Add 10ul of diluted sample to the reaction mix in the PCR tubes and mix. Avoid formation of bubbles.
- Seal tubes. If necessary (if you have air bubbles), briefly spin.
- Load cycler and start reaction:
42 degC 20 min (RT)
95 degC 2 min (activation) This can be variable according to specific Hotstart Taq
95 degC 5 sec
60 degC 5 sec
72 degC 15 sec 40 cycles
80 degC 7 sec acquisition
Melting curve
Reagents:
2x Lysis buffer:
0.25% Triton X-100, 50mM KCl, 100mM TrisHCl pH7.4, 40% glycerol. Add 2ul of RNAse inhibitor/100ul of 2x lysis buffer. RNAse inhibitor is stable in lysis buffer for a few weeks (since it does not freeze). You can therefore prepare a big aliquot (500ul) with inhibitor according to usage.
10x core buffer:
50 mM (NH4)2SO4, 200 mM KCl and 200 mM Tris–HCl pH 8.3.
2x reaction buffer:
5mM (NH4)2SO4, 20mM KCl and 20mM Tris–Cl pH 8.3, 10mM MgCl2, 0.2mg/ml BSA, 1/10,000 SYBR Green I, 400μM dNTPs, 1μM forward primer,1μM reverse primer, 7pmoles/ml MS2 RNA. Prepare it using core buffer according to the table below.
Store in 50ul or 100ul aliquots at -80.
SYBR green: dilute the original stock 1/100 in TE pH8. Aliquot (20ul) and store at -80. Once thawed, do not reuse.
MS2: original stock should be 0.8µg/µl, i.e. 0.7 pmoles/µl. Aliquot and store at -80.
Reagents and providers
Taq: Fermentas Truestart Hotstart Taq (EP0612) or Promega Hotstart goTaq or Eurogentec HotDiamond Taq (#M5001) or Solis Biodyne Hot Firepol. Any of these work well, but remember to adjust the activation time accordingly.
Fermentas Ribolock RNase inhibitor (E00381).
Roche MS2 RNA (10165948001)
Invitrogen SYBR Green I (S-7563)
Primer 1 fw: tcctgctcaacttcctgtcgag
Primer 2 rev: CACAGGTCAAACCTCCTAGGAATG (primers do not need highest purity, just desalted)
BSA from NEB restriction enzymes